Transcript: Mouse XM_011246800.1

PREDICTED: Mus musculus GRAM domain containing 3 (Gramd3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gramd3 (107022)
Length:
2522
CDS:
16..1359

Additional Resources:

NCBI RefSeq record:
XM_011246800.1
NBCI Gene record:
Gramd3 (107022)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011246800.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328915 CATGCACTTTCACAAGTTATT pLKO_005 387 CDS 100% 13.200 18.480 N Gramd3 n/a
2 TRCN0000328914 CGGTCACAGACAGGTACATAT pLKO_005 629 CDS 100% 13.200 18.480 N Gramd3 n/a
3 TRCN0000328916 TAGCACGAGGGTTATGGTAAT pLKO_005 1634 3UTR 100% 10.800 15.120 N Gramd3 n/a
4 TRCN0000200909 CCAACATAAATACCTCACGTT pLKO.1 1377 3UTR 100% 2.640 3.696 N Gramd3 n/a
5 TRCN0000191582 GCTAACATAGTGAAATTGGAA pLKO.1 1294 CDS 100% 3.000 2.400 N Gramd3 n/a
6 TRCN0000328982 TGATAGTCTATGCAATTATTG pLKO_005 1100 CDS 100% 13.200 9.240 N Gramd3 n/a
7 TRCN0000192756 CCAAGAACTTACAGCTAACAT pLKO.1 1281 CDS 100% 5.625 3.938 N Gramd3 n/a
8 TRCN0000328981 CCAAGAACTTACAGCTAACAT pLKO_005 1281 CDS 100% 5.625 3.938 N Gramd3 n/a
9 TRCN0000200988 CATCACATCCTGATAGTCTAT pLKO.1 1090 CDS 100% 4.950 3.465 N Gramd3 n/a
10 TRCN0000201816 GCCAAGAACTTACAGCTAACA pLKO.1 1280 CDS 100% 4.950 3.465 N Gramd3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011246800.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.