Transcript: Mouse XM_011246906.1

PREDICTED: Mus musculus centrosomal protein 120 (Cep120), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cep120 (225523)
Length:
5464
CDS:
1134..3824

Additional Resources:

NCBI RefSeq record:
XM_011246906.1
NBCI Gene record:
Cep120 (225523)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011246906.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178907 CGATGTTACAAACGAGCCTTT pLKO.1 1817 CDS 100% 4.050 5.670 N Cep120 n/a
2 TRCN0000216045 CAAATTAGTCATTGCTTAAAC pLKO.1 4497 3UTR 100% 13.200 10.560 N Cep120 n/a
3 TRCN0000179007 CGAAGGACATTGTTGCAGTAT pLKO.1 1624 CDS 100% 4.950 3.960 N Cep120 n/a
4 TRCN0000179082 CCAGAATTTGCTACTGAGCTA pLKO.1 1281 CDS 100% 2.640 2.112 N Cep120 n/a
5 TRCN0000217178 CATCGATTCCCAGTCTTTAAT pLKO.1 2159 CDS 100% 15.000 10.500 N Cep120 n/a
6 TRCN0000179546 GAAGGGCAGTACAGAGATTAA pLKO.1 2009 CDS 100% 13.200 9.240 N Cep120 n/a
7 TRCN0000183949 CCGATCAAACTCCAGTGCTTT pLKO.1 1353 CDS 100% 4.950 3.465 N Cep120 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011246906.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14406 pDONR223 100% 36% 35.3% None (many diffs) n/a
2 ccsbBroad304_14406 pLX_304 0% 36% 35.3% V5 (many diffs) n/a
Download CSV