Transcript: Mouse XM_011247080.2

PREDICTED: Mus musculus rotatin (Rttn), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rttn (246102)
Length:
6062
CDS:
831..5732

Additional Resources:

NCBI RefSeq record:
XM_011247080.2
NBCI Gene record:
Rttn (246102)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247080.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336106 ACCGCACATGGACGCATTTAT pLKO_005 4264 CDS 100% 15.000 21.000 N Rttn n/a
2 TRCN0000175599 CGTCAACACTTCTTCCTGAAA pLKO.1 3757 CDS 100% 4.950 3.960 N Rttn n/a
3 TRCN0000336164 CGTCAACACTTCTTCCTGAAA pLKO_005 3757 CDS 100% 4.950 3.960 N Rttn n/a
4 TRCN0000336104 AGCAGCTGCTCCCTGAATAAT pLKO_005 5796 3UTR 100% 15.000 10.500 N Rttn n/a
5 TRCN0000174284 CCAGAGTTACTAATCTGTTTA pLKO.1 1462 CDS 100% 13.200 9.240 N Rttn n/a
6 TRCN0000336163 CCAGAGTTACTAATCTGTTTA pLKO_005 1462 CDS 100% 13.200 9.240 N Rttn n/a
7 TRCN0000336105 CGGTTCGTTCACTAGCATTAA pLKO_005 1366 CDS 100% 13.200 9.240 N Rttn n/a
8 TRCN0000175598 CCCATTTCTATGGCTTACCTT pLKO.1 2821 CDS 100% 3.000 2.100 N Rttn n/a
9 TRCN0000174972 GCTCTAACTTACAATTACCAA pLKO.1 5553 CDS 100% 3.000 2.100 N Rttn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247080.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.