Transcript: Mouse XM_011247234.2

PREDICTED: Mus musculus COBW domain containing 1 (Cbwd1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cbwd1 (226043)
Length:
1315
CDS:
46..639

Additional Resources:

NCBI RefSeq record:
XM_011247234.2
NBCI Gene record:
Cbwd1 (226043)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247234.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197585 CTATGATATTCTCTCTGGAAT pLKO.1 192 CDS 100% 4.950 6.930 N Cbwd1 n/a
2 TRCN0000176700 CAGACATGATTCTCATCAATA pLKO.1 41 5UTR 100% 13.200 9.240 N Cbwd1 n/a
3 TRCN0000215755 GAACAACTATCAGATCAATAA pLKO.1 101 CDS 100% 13.200 9.240 N Cbwd1 n/a
4 TRCN0000197919 GCAGACATGATTCTCATCAAT pLKO.1 40 5UTR 100% 5.625 3.938 N Cbwd1 n/a
5 TRCN0000198419 GCTGGTCTTCATTGGTAGAAA pLKO.1 516 CDS 100% 5.625 3.938 N Cbwd1 n/a
6 TRCN0000177047 GAGTATTGTTACAGTCACATT pLKO.1 264 CDS 100% 4.950 3.465 N Cbwd1 n/a
7 TRCN0000177842 CTAGTGAACTGGAAGGATGAT pLKO.1 478 CDS 100% 0.000 0.000 N Cbwd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247234.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.