Transcript: Mouse XM_011247289.1

PREDICTED: Mus musculus N-acylsphingosine amidohydrolase 2 (Asah2), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Asah2 (54447)
Length:
6908
CDS:
477..2747

Additional Resources:

NCBI RefSeq record:
XM_011247289.1
NBCI Gene record:
Asah2 (54447)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247289.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124731 CGCAGGTCTAAGCAATGTTTA pLKO.1 2111 CDS 100% 13.200 18.480 N Asah2 n/a
2 TRCN0000327005 CGCAGGTCTAAGCAATGTTTA pLKO_005 2111 CDS 100% 13.200 18.480 N Asah2 n/a
3 TRCN0000124732 CCCGCTGTCATACTAGCATTT pLKO.1 2688 CDS 100% 10.800 15.120 N Asah2 n/a
4 TRCN0000326943 CCCGCTGTCATACTAGCATTT pLKO_005 2688 CDS 100% 10.800 15.120 N Asah2 n/a
5 TRCN0000124733 GCATTGATATAGCTCACACAA pLKO.1 1093 CDS 100% 4.950 6.930 N Asah2 n/a
6 TRCN0000326945 GCATTGATATAGCTCACACAA pLKO_005 1093 CDS 100% 4.950 6.930 N Asah2 n/a
7 TRCN0000124730 GCGTGGAACTATGTATGATTT pLKO.1 874 CDS 100% 13.200 9.240 N Asah2 n/a
8 TRCN0000326942 GCGTGGAACTATGTATGATTT pLKO_005 874 CDS 100% 13.200 9.240 N Asah2 n/a
9 TRCN0000124729 CCCTGAAATATAATGACAGTA pLKO.1 3158 3UTR 100% 4.950 3.465 N Asah2 n/a
10 TRCN0000327003 CCCTGAAATATAATGACAGTA pLKO_005 3158 3UTR 100% 4.950 3.465 N Asah2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247289.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.