Transcript: Mouse XM_011247345.2

PREDICTED: Mus musculus RIKEN cDNA 9130011E15 gene (9130011E15Rik), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
9130011E15Rik (71617)
Length:
3820
CDS:
229..2298

Additional Resources:

NCBI RefSeq record:
XM_011247345.2
NBCI Gene record:
9130011E15Rik (71617)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247345.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197412 CCTTATGATTGTGAACCTATT pLKO.1 1800 CDS 100% 10.800 15.120 N 9130011E15Rik n/a
2 TRCN0000177309 GTTCATTGTAACACACATGAT pLKO.1 1587 CDS 100% 4.950 3.960 N 9130011E15Rik n/a
3 TRCN0000216882 GAGTACAACAGGCAGTATAAA pLKO.1 988 CDS 100% 15.000 10.500 N 9130011E15Rik n/a
4 TRCN0000418864 GAGTACAACAGGCAGTATAAA pLKO_005 988 CDS 100% 15.000 10.500 N ARMH3 n/a
5 TRCN0000200345 GCAGCTACGATGAGCTTTACT pLKO.1 1865 CDS 100% 5.625 3.938 N 9130011E15Rik n/a
6 TRCN0000181465 CAAAGTTGACACCTCTGAGAA pLKO.1 2810 3UTR 100% 4.950 3.465 N 9130011E15Rik n/a
7 TRCN0000198818 CAGAGCCATCATCAATCACTT pLKO.1 2007 CDS 100% 4.950 3.465 N 9130011E15Rik n/a
8 TRCN0000178406 GCTGAAGTTCCTTATGTCAAA pLKO.1 1737 CDS 100% 4.950 3.465 N 9130011E15Rik n/a
9 TRCN0000200284 CTGACTATACAGGTGCTGGTT pLKO.1 2586 3UTR 100% 2.640 1.848 N 9130011E15Rik n/a
10 TRCN0000129458 GCCTTCTTCAAAGAGCTGGTT pLKO.1 2188 CDS 100% 2.640 1.848 N ARMH3 n/a
11 TRCN0000130977 CCAGAGCTTTGACAACCTCTA pLKO.1 1905 CDS 100% 4.050 2.430 N ARMH3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247345.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.