Transcript: Mouse XM_011247407.1

PREDICTED: Mus musculus carboxypeptidase N, polypeptide 1 (Cpn1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cpn1 (93721)
Length:
1841
CDS:
264..1655

Additional Resources:

NCBI RefSeq record:
XM_011247407.1
NBCI Gene record:
Cpn1 (93721)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247407.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222009 GCACAACCAATGCCCGGACAT pLKO.1 377 CDS 100% 1.350 1.080 N Cpn1 n/a
2 TRCN0000313365 CTTCGTTCTCTCAGCCAATAT pLKO_005 905 CDS 100% 13.200 9.240 N Cpn1 n/a
3 TRCN0000222010 GTATTCTCTCAGCAAGGGAAT pLKO.1 1136 CDS 100% 4.050 2.835 N Cpn1 n/a
4 TRCN0000312340 GTATTCTCTCAGCAAGGGAAT pLKO_005 1136 CDS 100% 4.050 2.835 N Cpn1 n/a
5 TRCN0000033051 CCAACAGTGGTTGACTTCCAA pLKO.1 1503 CDS 100% 3.000 2.100 N Cpn1 n/a
6 TRCN0000312282 CCAACAGTGGTTGACTTCCAA pLKO_005 1503 CDS 100% 3.000 2.100 N Cpn1 n/a
7 TRCN0000222008 CGGAAGTCAAGTATGTGGGAA pLKO.1 493 CDS 100% 2.640 1.848 N Cpn1 n/a
8 TRCN0000312339 CGGAAGTCAAGTATGTGGGAA pLKO_005 493 CDS 100% 2.640 1.848 N Cpn1 n/a
9 TRCN0000313302 AGCTGAGTTGCGACAAGTTTC pLKO_005 1204 CDS 100% 10.800 6.480 N Cpn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247407.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.