Transcript: Mouse XM_011247454.1

PREDICTED: Mus musculus ubiquitin specific peptidase 9, X chromosome (Usp9x), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Usp9x (22284)
Length:
12301
CDS:
730..8457

Additional Resources:

NCBI RefSeq record:
XM_011247454.1
NBCI Gene record:
Usp9x (22284)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247454.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238352 GATAATTGCAGCCCTTATTAA pLKO_005 1479 CDS 100% 15.000 21.000 N Usp9x n/a
2 TRCN0000238354 TCGTAATGTATGCCAATTTAG pLKO_005 7289 CDS 100% 13.200 18.480 N Usp9x n/a
3 TRCN0000030759 CGGCTTAACTTTCTTAGGTTT pLKO.1 2713 CDS 100% 4.950 3.960 N Usp9x n/a
4 TRCN0000238350 ATGCACTGAATGAGGTTAATA pLKO_005 1787 CDS 100% 15.000 10.500 N Usp9x n/a
5 TRCN0000238351 TTCTGTGTCTGGCTAATATTT pLKO_005 8518 3UTR 100% 15.000 10.500 N Usp9x n/a
6 TRCN0000238353 CCGCCAGATAGTACGACAATA pLKO_005 3886 CDS 100% 13.200 9.240 N Usp9x n/a
7 TRCN0000030761 GCAGAAGAAATCACTATGATT pLKO.1 6853 CDS 100% 5.625 3.938 N Usp9x n/a
8 TRCN0000030763 CCTCAACAAGTTTGGCACTTT pLKO.1 1401 CDS 100% 4.950 3.465 N Usp9x n/a
9 TRCN0000030760 GCCCAAATGAAGAAGTGACAA pLKO.1 4520 CDS 100% 4.950 3.465 N Usp9x n/a
10 TRCN0000030762 GCCGAGCTATTGATCTCCTTA pLKO.1 3104 CDS 100% 4.950 3.465 N Usp9x n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247454.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.