Transcript: Mouse XM_011247558.2

PREDICTED: Mus musculus X-linked lymphocyte-regulated 3A (Xlr3a), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Xlr3a (22445)
Length:
754
CDS:
139..687

Additional Resources:

NCBI RefSeq record:
XM_011247558.2
NBCI Gene record:
Xlr3a (22445)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247558.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255203 CTGGTAGGGAGGACATTATTT pLKO_005 266 CDS 100% 15.000 7.500 Y Xlr3b n/a
2 TRCN0000249028 GCTGGTAGGGAGGACATTATT pLKO_005 265 CDS 100% 15.000 7.500 Y Xlr3c n/a
3 TRCN0000257849 TATGGAGCAACAGAAGTTTAT pLKO_005 576 CDS 100% 13.200 6.600 Y Xlr3c n/a
4 TRCN0000255204 TCGAAGAGCCACCTAACAAAG pLKO_005 344 CDS 100% 10.800 5.400 Y Xlr3b n/a
5 TRCN0000183016 CGAAACACTCTCTAATATGTT pLKO.1 555 CDS 100% 5.625 2.813 Y Xlr3a n/a
6 TRCN0000179260 GCTAACAGAGAAGTCCTTGAT pLKO.1 244 CDS 100% 4.950 2.475 Y Xlr3a n/a
7 TRCN0000183771 CCTAACAAAGTTCTTCAGGAA pLKO.1 355 CDS 100% 2.640 1.320 Y Xlr3a n/a
8 TRCN0000191756 GCATACAAACTCAAGAAACAT pLKO.1 532 CDS 100% 5.625 2.813 Y Xlr3c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247558.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.