Transcript: Mouse XM_011247563.1

PREDICTED: Mus musculus alpha thalassemia/mental retardation syndrome X-linked (Atrx), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atrx (22589)
Length:
9946
CDS:
16..7386

Additional Resources:

NCBI RefSeq record:
XM_011247563.1
NBCI Gene record:
Atrx (22589)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247563.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081909 CCCACGGATGAGAATGTAAAT pLKO.1 349 CDS 100% 13.200 18.480 N Atrx n/a
2 TRCN0000302074 CCCACGGATGAGAATGTAAAT pLKO_005 349 CDS 100% 13.200 18.480 N Atrx n/a
3 TRCN0000013588 GCCTGCTAAATTCTCCACATT pLKO.1 9564 3UTR 100% 4.950 3.960 N ATRX n/a
4 TRCN0000081911 CCACTAACACTCCTGAGGATT pLKO.1 1439 CDS 100% 4.950 3.465 N Atrx n/a
5 TRCN0000302007 CCACTAACACTCCTGAGGATT pLKO_005 1439 CDS 100% 4.950 3.465 N Atrx n/a
6 TRCN0000081910 CCTGTCACTTTCACCTCTCAA pLKO.1 6799 CDS 100% 4.950 3.465 N Atrx n/a
7 TRCN0000302071 CCTGTCACTTTCACCTCTCAA pLKO_005 6799 CDS 100% 4.950 3.465 N Atrx n/a
8 TRCN0000081908 CCTTCTAACTACCAGCAGATT pLKO.1 7246 CDS 100% 4.950 3.465 N Atrx n/a
9 TRCN0000302006 CCTTCTAACTACCAGCAGATT pLKO_005 7246 CDS 100% 4.950 3.465 N Atrx n/a
10 TRCN0000013589 GCAGATTGATATGAGAGGAAT pLKO.1 7260 CDS 100% 4.950 3.465 N ATRX n/a
11 TRCN0000081912 GCTATGAAGTTATGTCAACTT pLKO.1 1105 CDS 100% 0.495 0.347 N Atrx n/a
12 TRCN0000302073 GCTATGAAGTTATGTCAACTT pLKO_005 1105 CDS 100% 0.495 0.347 N Atrx n/a
13 TRCN0000342876 GAGTTGATTCCTCAAGTTATG pLKO_005 7790 3UTR 100% 10.800 7.560 N ATRX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247563.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.