Transcript: Mouse XM_011247676.1

PREDICTED: Mus musculus RIKEN cDNA 3830403N18 gene (3830403N18Rik), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
3830403N18Rik (70691)
Length:
619
CDS:
1..540

Additional Resources:

NCBI RefSeq record:
XM_011247676.1
NBCI Gene record:
3830403N18Rik (70691)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247676.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217296 GCTCCAGAATTGGACCTTATT pLKO.1 211 CDS 100% 13.200 7.920 N 3830403N18Rik n/a
2 TRCN0000283253 GCTCCAGAATTGGACCTTATT pLKO_005 211 CDS 100% 13.200 7.920 N 3830403N18Rik n/a
3 TRCN0000216430 GACTAAGGAAGCATGCATATT pLKO.1 535 CDS 100% 13.200 6.600 Y 3830403N18Rik n/a
4 TRCN0000264953 TGATATGGATGTCCAGAAATT pLKO_005 354 CDS 100% 13.200 6.600 Y 3830403N18Rik n/a
5 TRCN0000262246 ACTTATTACTTCTTGACTTTG pLKO_005 41 CDS 100% 10.800 5.400 Y Slx n/a
6 TRCN0000272118 TGAAGAAGTAGTTGGAGATAC pLKO_005 276 CDS 100% 10.800 5.400 Y Gm14819 n/a
7 TRCN0000283250 TTGCACTTGCTGGTACATTTG pLKO_005 556 3UTR 100% 10.800 5.400 Y 3830403N18Rik n/a
8 TRCN0000267556 GTAGTTGGAGATACACGAAAG pLKO_005 283 CDS 100% 6.000 3.000 Y Gm6121 n/a
9 TRCN0000270058 AGTTGGAGATACACGAAAGAA pLKO_005 285 CDS 100% 5.625 2.813 Y Gm5168 n/a
10 TRCN0000284666 ACAGAATCCAGTAACTCATGA pLKO_005 237 CDS 100% 4.950 2.475 Y Gm10058 n/a
11 TRCN0000347861 AGTAGTTGGAGATACACGAAA pLKO_005 282 CDS 100% 4.950 2.475 Y Gm14525 n/a
12 TRCN0000363996 AGTAGTTGGAGATACACGAAA pLKO_005 282 CDS 100% 4.950 2.475 Y Gm10487 n/a
13 TRCN0000272192 CAGAATCCAGTAACTCATGAT pLKO_005 238 CDS 100% 4.950 2.475 Y Gm10230 n/a
14 TRCN0000179535 GAACTTGGAGACCAACAACTA pLKO.1 408 CDS 100% 4.950 2.475 Y 3830403N18Rik n/a
15 TRCN0000197782 GTCCAGAAATTCAATGAAGAA pLKO.1 364 CDS 100% 4.950 2.475 Y Xlr n/a
16 TRCN0000272234 GTTGGAGATACACGAAAGAAG pLKO_005 286 CDS 100% 4.950 2.475 Y Gm10147 n/a
17 TRCN0000270443 TAGTTGGAGATACACGAAAGA pLKO_005 284 CDS 100% 4.950 2.475 Y Gm5935 n/a
18 TRCN0000255756 TTTCCCATCTTCAGACTAATG pLKO_005 522 CDS 100% 10.800 5.400 Y Gm1993 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247676.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.