Transcript: Mouse XM_011247693.2

PREDICTED: Mus musculus oligophrenin 1 (Ophn1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ophn1 (94190)
Length:
4019
CDS:
1054..3429

Additional Resources:

NCBI RefSeq record:
XM_011247693.2
NBCI Gene record:
Ophn1 (94190)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247693.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113071 GCGGAATCATTCAAGGAATTT pLKO.1 1303 CDS 100% 13.200 18.480 N Ophn1 n/a
2 TRCN0000317723 GCGGAATCATTCAAGGAATTT pLKO_005 1303 CDS 100% 13.200 18.480 N Ophn1 n/a
3 TRCN0000350063 GGGATATCCTGGGCGAAATAC pLKO_005 1894 CDS 100% 13.200 18.480 N Ophn1 n/a
4 TRCN0000113072 GCGAAATACTATTGTCGGTAT pLKO.1 1906 CDS 100% 4.050 5.670 N Ophn1 n/a
5 TRCN0000319531 CTATTCACTCCCTAGTATATA pLKO_005 2504 CDS 100% 15.000 10.500 N Ophn1 n/a
6 TRCN0000380261 TATCTACCACACTCCTATAAC pLKO_005 2157 CDS 100% 13.200 9.240 N Ophn1 n/a
7 TRCN0000319458 TCCGCCAGAGGCTCAAGTATT pLKO_005 1106 CDS 100% 13.200 9.240 N Ophn1 n/a
8 TRCN0000380230 TGTTAGGAAGTGCATCAATTT pLKO_005 2220 CDS 100% 13.200 9.240 N Ophn1 n/a
9 TRCN0000113073 GCTACTCCAAAGGCTTCCAAT pLKO.1 3103 CDS 100% 4.950 3.465 N Ophn1 n/a
10 TRCN0000113074 CCGAAGCCAATAGAAGGCTAT pLKO.1 2108 CDS 100% 4.050 2.835 N Ophn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247693.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.