Transcript: Mouse XM_011247796.2

PREDICTED: Mus musculus RALBP1 associated Eps domain containing protein 2 (Reps2), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Reps2 (194590)
Length:
7331
CDS:
199..1908

Additional Resources:

NCBI RefSeq record:
XM_011247796.2
NBCI Gene record:
Reps2 (194590)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247796.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249384 TCGTCGGCAGGCATCTCTTAT pLKO_005 903 CDS 100% 13.200 18.480 N Reps2 n/a
2 TRCN0000249385 AGCGGGAGTACTACGTCAATC pLKO_005 1004 CDS 100% 10.800 15.120 N Reps2 n/a
3 TRCN0000217258 CTAGGCCATCAACCTAGATAA pLKO.1 2761 3UTR 100% 1.320 1.848 N Reps2 n/a
4 TRCN0000257881 GTGAGAACAGAGAGTATTAAA pLKO_005 532 CDS 100% 15.000 10.500 N Reps2 n/a
5 TRCN0000249386 AGGTTCAGATTCCATACTTAA pLKO_005 638 CDS 100% 13.200 9.240 N Reps2 n/a
6 TRCN0000257874 ATAGATTCCAGCCGCATATTC pLKO_005 5356 3UTR 100% 13.200 9.240 N Reps2 n/a
7 TRCN0000201542 CGGATGGAGAAGACATCTGTT pLKO.1 1360 CDS 100% 4.950 3.465 N Reps2 n/a
8 TRCN0000201469 CCAACAAAGATGGATGCACCA pLKO.1 1576 CDS 100% 2.160 1.512 N Reps2 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4220 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247796.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.