Transcript: Mouse XM_011247859.1

PREDICTED: Mus musculus HECT, UBA and WWE domain containing 1 (Huwe1), transcript variant X20, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Huwe1 (59026)
Length:
14838
CDS:
1191..14324

Additional Resources:

NCBI RefSeq record:
XM_011247859.1
NBCI Gene record:
Huwe1 (59026)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247859.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000092553 GCACTCTTCATAACTCACTTT pLKO.1 14817 3UTR 100% 4.950 6.930 N Huwe1 n/a
2 TRCN0000092554 CCGCACTGTGTTAAACCAGAT pLKO.1 13085 CDS 100% 4.050 5.670 N Huwe1 n/a
3 TRCN0000327552 CCGCACTGTGTTAAACCAGAT pLKO_005 13085 CDS 100% 4.050 5.670 N Huwe1 n/a
4 TRCN0000344549 TGCACAGCTAATGATTCAATG pLKO_005 14752 3UTR 100% 10.800 8.640 N HUWE1 n/a
5 TRCN0000347015 TGCACAGCTAATGATTCAATG pLKO_005 14752 3UTR 100% 10.800 8.640 N Huwe1 n/a
6 TRCN0000344529 TTTGATGTCAAGCGCAAATAT pLKO_005 13179 CDS 100% 15.000 10.500 N HUWE1 n/a
7 TRCN0000092555 CCACAAATATGCCATGATGTT pLKO.1 6554 CDS 100% 4.950 3.465 N Huwe1 n/a
8 TRCN0000327613 CCACAAATATGCCATGATGTT pLKO_005 6554 CDS 100% 4.950 3.465 N Huwe1 n/a
9 TRCN0000092557 CCACTACTGTTTCAACTTCTA pLKO.1 11821 CDS 100% 4.950 3.465 N Huwe1 n/a
10 TRCN0000092556 GCACTGCTCATCAAAGATGTT pLKO.1 2952 CDS 100% 4.950 3.465 N Huwe1 n/a
11 TRCN0000327534 GCACTGCTCATCAAAGATGTT pLKO_005 2952 CDS 100% 4.950 3.465 N Huwe1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247859.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.