Transcript: Mouse XM_011247945.3

PREDICTED: Mus musculus SRY (sex determining region Y)-box 13 (Sox13), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Sox13 (20668)
Length:
3297
CDS:
81..1946

Additional Resources:

NCBI RefSeq record:
XM_011247945.3
NBCI Gene record:
Sox13 (20668)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247945.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085534 GCTTTACCTATTCAGCCCATT pLKO.1 825 CDS 100% 4.050 5.670 N Sox13 n/a
2 TRCN0000013480 CCAGCAGGTTAACATGCCTTA pLKO.1 740 CDS 100% 4.050 3.240 N SOX13 n/a
3 TRCN0000435324 ACATCAAGAGACCCATGAATG pLKO_005 1348 CDS 100% 10.800 7.560 N Sox13 n/a
4 TRCN0000422921 TGGACTTCAACCGCAACTTAC pLKO_005 370 CDS 100% 10.800 7.560 N Sox13 n/a
5 TRCN0000085533 CCTGGTTGTATCCCAAGGAAA pLKO.1 3041 3UTR 100% 4.950 3.465 N Sox13 n/a
6 TRCN0000085535 GCTGATTCAACAGCAGCACAA pLKO.1 695 CDS 100% 4.050 2.835 N Sox13 n/a
7 TRCN0000085536 CACTTGTAGATACATTCCCAA pLKO.1 2078 3UTR 100% 2.640 1.848 N Sox13 n/a
8 TRCN0000085537 GCACTTGTAGATACATTCCCA pLKO.1 2077 3UTR 100% 0.750 0.525 N Sox13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247945.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.