Transcript: Mouse XM_011248050.2

PREDICTED: Mus musculus receptor (calcitonin) activity modifying protein 1 (Ramp1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ramp1 (51801)
Length:
1649
CDS:
933..1331

Additional Resources:

NCBI RefSeq record:
XM_011248050.2
NBCI Gene record:
Ramp1 (51801)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248050.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436829 AGAGGGCATCGTGTAGGTATC pLKO_005 1316 CDS 100% 6.000 8.400 N Ramp1 n/a
2 TRCN0000430122 TTACGGTCACGCTGCTCATGA pLKO_005 1264 CDS 100% 4.950 6.930 N Ramp1 n/a
3 TRCN0000425491 GATGCACAGTTTGTGATTAAA pLKO_005 1610 3UTR 100% 15.000 10.500 N Ramp1 n/a
4 TRCN0000042768 GCTCTGCATTAAGCTGAATAT pLKO.1 1445 3UTR 100% 13.200 9.240 N Ramp1 n/a
5 TRCN0000442040 ATCCTGCTCTAGCCTAGTTAG pLKO_005 1407 3UTR 100% 10.800 7.560 N Ramp1 n/a
6 TRCN0000042770 CCCTGACTATGGGACTCTCAT pLKO.1 971 CDS 100% 4.950 3.465 N Ramp1 n/a
7 TRCN0000042769 CCACCATCGATACTTCAGCAA pLKO.1 1172 CDS 100% 2.640 1.848 N Ramp1 n/a
8 TRCN0000042772 GAGACTATTGGGAAGACGCTA pLKO.1 1029 CDS 100% 2.640 1.848 N Ramp1 n/a
9 TRCN0000042771 GTGGACAGATTCTTCATCGCT pLKO.1 1149 CDS 100% 0.750 0.525 N Ramp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248050.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.