Transcript: Mouse XM_011248115.1

PREDICTED: Mus musculus component of Sp100-rs-like (LOC101055758), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
LOC101055758 (101055758)
Length:
2793
CDS:
142..1233

Additional Resources:

NCBI RefSeq record:
XM_011248115.1
NBCI Gene record:
LOC101055758 (101055758)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248115.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272023 CAATACTTACCTCGCTATTTG pLKO_005 681 CDS 100% 13.200 6.600 Y Gm7609 n/a
2 TRCN0000271980 CTGCTGTGTTGGCTGGTATTT pLKO_005 604 CDS 100% 13.200 6.600 Y Gm7609 n/a
3 TRCN0000249701 TCAATACTTACCTCGCTATTT pLKO_005 680 CDS 100% 13.200 6.600 Y Csprs n/a
4 TRCN0000249699 TGCTGTGTTGGCTGGTATTTG pLKO_005 605 CDS 100% 13.200 6.600 Y Csprs n/a
5 TRCN0000272022 ACCGTTGTCATTATCGCAATA pLKO_005 448 CDS 100% 10.800 5.400 Y Gm7609 n/a
6 TRCN0000092794 CCATTTCTAATGCGATAAGAA pLKO.1 68 5UTR 100% 5.625 2.813 Y Sp100 n/a
7 TRCN0000193834 CTTGTTCATCTACTGCAGATA pLKO.1 1012 CDS 100% 4.950 2.475 Y Csprs n/a
8 TRCN0000173867 GATCCTCCTTACTCTGACCTT pLKO.1 651 CDS 100% 2.640 1.320 Y Csprs n/a
9 TRCN0000249703 TACCTACCCTGATAATCATAG pLKO_005 1046 CDS 100% 0.000 0.000 Y Csprs n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248115.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.