Transcript: Mouse XM_011248198.1

PREDICTED: Mus musculus N(alpha)-acetyltransferase 25, NatB auxiliary subunit (Naa25), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Naa25 (231713)
Length:
5561
CDS:
128..2962

Additional Resources:

NCBI RefSeq record:
XM_011248198.1
NBCI Gene record:
Naa25 (231713)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248198.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217225 CCAATGCTGTGGATCATATTA pLKO.1 2748 CDS 100% 15.000 21.000 N Naa25 n/a
2 TRCN0000215792 CTTGCGACCATACAAATTAAA pLKO.1 2626 CDS 100% 15.000 21.000 N Naa25 n/a
3 TRCN0000215845 CTTCTTCGTTGAGACTATTTC pLKO.1 2569 CDS 100% 13.200 18.480 N Naa25 n/a
4 TRCN0000177136 GAAGAGTTAATGTTCCAGTAT pLKO.1 1088 CDS 100% 4.950 6.930 N Naa25 n/a
5 TRCN0000197966 GCTTGATCATGCAATCTATAT pLKO.1 507 CDS 100% 13.200 10.560 N Naa25 n/a
6 TRCN0000216126 CATCCAATGCTCAGTTCAAAT pLKO.1 1551 CDS 100% 13.200 9.240 N Naa25 n/a
7 TRCN0000217493 GGCAATTCAGCAAGCTGATAA pLKO.1 130 CDS 100% 13.200 9.240 N Naa25 n/a
8 TRCN0000217681 GTTGCAGTTCTCAGACTATTA pLKO.1 1423 CDS 100% 13.200 9.240 N Naa25 n/a
9 TRCN0000177806 CAGCATGGATAAGAGTCAGAA pLKO.1 1327 CDS 100% 4.950 3.465 N Naa25 n/a
10 TRCN0000181777 GCATCACAAAGCTCTCGACAT pLKO.1 980 CDS 100% 4.050 2.835 N Naa25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248198.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.