Transcript: Mouse XM_011248246.2

PREDICTED: Mus musculus Rab interacting lysosomal protein-like 1 (Rilpl1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rilpl1 (75695)
Length:
2711
CDS:
1445..2623

Additional Resources:

NCBI RefSeq record:
XM_011248246.2
NBCI Gene record:
Rilpl1 (75695)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248246.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220567 GCCTACTATAAGAGTGAAGAA pLKO.1 2414 CDS 100% 4.950 6.930 N Rilpl1 n/a
2 TRCN0000220570 GACGAGGCTAATGAAGATCAA pLKO.1 2038 CDS 100% 4.950 3.960 N Rilpl1 n/a
3 TRCN0000312133 GACGAGGCTAATGAAGATCAA pLKO_005 2038 CDS 100% 4.950 3.960 N Rilpl1 n/a
4 TRCN0000349873 AGAGGAACTGGCCTACTATAA pLKO_005 2404 CDS 100% 13.200 9.240 N Rilpl1 n/a
5 TRCN0000313111 ATAGAAGAAGAGAATCGAATA pLKO_005 2435 CDS 100% 10.800 7.560 N Rilpl1 n/a
6 TRCN0000220569 CCAGATGGAGAGGAATCGATT pLKO.1 2261 CDS 100% 4.950 3.465 N Rilpl1 n/a
7 TRCN0000312134 CCAGATGGAGAGGAATCGATT pLKO_005 2261 CDS 100% 4.950 3.465 N Rilpl1 n/a
8 TRCN0000220568 CCGTCATGGATGTGTACGATA pLKO.1 1512 CDS 100% 4.950 3.465 N Rilpl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248246.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.