Transcript: Mouse XM_011248667.2

PREDICTED: Mus musculus acetyl-Coenzyme A carboxylase alpha (Acaca), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Acaca (107476)
Length:
9528
CDS:
523..7560

Additional Resources:

NCBI RefSeq record:
XM_011248667.2
NBCI Gene record:
Acaca (107476)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248667.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000028937 CCTTCTTCAATCAAAGAGGTT pLKO.1 5262 CDS 100% 2.640 2.112 N Acaca n/a
2 TRCN0000028935 CCCAGCAGTATTTGAACACAT pLKO.1 1710 CDS 100% 4.950 3.465 N Acaca n/a
3 TRCN0000028934 CCTGTGTGTTTGAGAAGGAAA pLKO.1 2744 CDS 100% 4.950 3.465 N Acaca n/a
4 TRCN0000028938 GCATGGTAATGCGCTATGGAA pLKO.1 5000 CDS 100% 3.000 2.100 N Acaca n/a
5 TRCN0000028936 CCACAGGATCTGTATGAGAAA pLKO.1 1363 CDS 100% 4.950 2.970 N Acaca n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248667.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.