Transcript: Mouse XM_011249049.2

PREDICTED: Mus musculus BAH domain and coiled-coil containing 1 (Bahcc1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Bahcc1 (268515)
Length:
10905
CDS:
440..8506

Additional Resources:

NCBI RefSeq record:
XM_011249049.2
NBCI Gene record:
Bahcc1 (268515)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249049.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219604 GGCCCGATACAGCCTACAATA pLKO.1 2604 CDS 100% 13.200 18.480 N Bahcc1 n/a
2 TRCN0000177458 CGTATCTCTTACCTCTGTTTA pLKO.1 9343 3UTR 100% 13.200 10.560 N Bahcc1 n/a
3 TRCN0000242076 CAAAGTCTCCCGGGACCTAAA pLKO_005 1600 CDS 100% 10.800 8.640 N Bahcc1 n/a
4 TRCN0000182042 CGCATCCAGAAGAAGCTATCT pLKO.1 5273 CDS 100% 4.950 3.960 N Bahcc1 n/a
5 TRCN0000181431 CGGACTTCAAGATCCAGTGTA pLKO.1 6555 CDS 100% 4.950 3.960 N Bahcc1 n/a
6 TRCN0000181541 GAAGCGAAGCAAACTGGGAAA pLKO.1 5068 CDS 100% 4.050 3.240 N Bahcc1 n/a
7 TRCN0000242074 GAAATTACACTGCGGTTTATT pLKO_005 9161 3UTR 100% 15.000 10.500 N Bahcc1 n/a
8 TRCN0000242073 ACATGGTGGTGAAGGTCAAAT pLKO_005 8094 CDS 100% 13.200 9.240 N Bahcc1 n/a
9 TRCN0000242077 TCAGAAGTCCCGGTGTCTATA pLKO_005 6415 CDS 100% 13.200 9.240 N Bahcc1 n/a
10 TRCN0000242075 ACCGCTTCCTCATGGGTAAAG pLKO_005 1080 CDS 100% 10.800 7.560 N Bahcc1 n/a
11 TRCN0000158276 CAGCAACAACAGCAGCAACAA pLKO.1 3278 CDS 100% 4.950 2.475 Y RBMS3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249049.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.