Transcript: Mouse XM_011249106.2

PREDICTED: Mus musculus sperm antigen with calponin homology and coiled-coil domains 1 (Specc1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Specc1 (432572)
Length:
6972
CDS:
165..3341

Additional Resources:

NCBI RefSeq record:
XM_011249106.2
NBCI Gene record:
Specc1 (432572)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249106.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000347183 CAGTAAAGTCACTGATCAAAT pLKO_005 2593 CDS 100% 13.200 10.560 N Specc1 n/a
2 TRCN0000174871 GCGAACATTGATATCACCAAT pLKO.1 3072 CDS 100% 4.950 3.960 N Specc1 n/a
3 TRCN0000347255 GCGAACATTGATATCACCAAT pLKO_005 3072 CDS 100% 4.950 3.960 N Specc1 n/a
4 TRCN0000347184 CAGACCTAGAGCGGCAGTTAA pLKO_005 2266 CDS 100% 13.200 9.240 N Specc1 n/a
5 TRCN0000173869 GCGCCGTCAAGTTACACAATA pLKO.1 2191 CDS 100% 13.200 9.240 N Specc1 n/a
6 TRCN0000347254 GCGCCGTCAAGTTACACAATA pLKO_005 2191 CDS 100% 13.200 9.240 N Specc1 n/a
7 TRCN0000176254 CAGGGACTATTCCAACAACTA pLKO.1 442 CDS 100% 4.950 3.465 N Specc1 n/a
8 TRCN0000174616 GCAGAAATAGAAACTGCGTTT pLKO.1 4299 3UTR 100% 4.050 2.835 N Specc1 n/a
9 TRCN0000347256 GCAGAAATAGAAACTGCGTTT pLKO_005 4299 3UTR 100% 4.050 2.835 N Specc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249106.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.