Transcript: Mouse XM_011249223.2

PREDICTED: Mus musculus proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 (Psmd11), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Psmd11 (69077)
Length:
2827
CDS:
254..1288

Additional Resources:

NCBI RefSeq record:
XM_011249223.2
NBCI Gene record:
Psmd11 (69077)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249223.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065921 CCCAATCATCAGCACACATTT pLKO.1 967 CDS 100% 13.200 18.480 N Psmd11 n/a
2 TRCN0000317318 CCCAATCATCAGCACACATTT pLKO_005 967 CDS 100% 13.200 18.480 N Psmd11 n/a
3 TRCN0000065919 CGAGTCCAGATTGAACACATA pLKO.1 1049 CDS 100% 4.950 6.930 N Psmd11 n/a
4 TRCN0000317247 CGAGTCCAGATTGAACACATA pLKO_005 1049 CDS 100% 4.950 6.930 N Psmd11 n/a
5 TRCN0000065920 CGGTCTCTTCTTGATCTGTTT pLKO.1 177 5UTR 100% 4.950 6.930 N Psmd11 n/a
6 TRCN0000087121 CGAGCTATGTTTAGAGTGCAT pLKO.1 340 CDS 100% 2.640 3.696 N LOC433477 n/a
7 TRCN0000065918 GTTGGATCTGTAGCGGTCCTT pLKO.1 1290 3UTR 100% 2.640 3.696 N Psmd11 n/a
8 TRCN0000313733 ATTCCATCAGTAAAGCTAAAG pLKO_005 142 5UTR 100% 10.800 7.560 N Psmd11 n/a
9 TRCN0000087122 GCAAGGCTGGTGTCTTTGTAT pLKO.1 410 CDS 100% 5.625 3.938 N LOC433477 n/a
10 TRCN0000065922 GCCAAGCTGTACGATAACTTA pLKO.1 989 CDS 100% 5.625 3.938 N Psmd11 n/a
11 TRCN0000313732 GGCTTACACTACCTAAAGCTG pLKO_005 1535 3UTR 100% 2.640 1.848 N Psmd11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249223.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.