Transcript: Mouse XM_011249322.2

PREDICTED: Mus musculus solute carrier family 16 (monocarboxylic acid transporters), member 3 (Slc16a3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc16a3 (80879)
Length:
2992
CDS:
937..2349

Additional Resources:

NCBI RefSeq record:
XM_011249322.2
NBCI Gene record:
Slc16a3 (80879)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249322.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000444671 AGGAGCTTATGCATGAGTTTG pLKO_005 1076 CDS 100% 10.800 15.120 N Slc16a3 n/a
2 TRCN0000452782 ATATGGGTGTACCCGACACAA pLKO_005 1712 CDS 100% 4.950 6.930 N Slc16a3 n/a
3 TRCN0000079657 GCTCAATCGATACTTCAACAA pLKO.1 1344 CDS 100% 4.950 6.930 N Slc16a3 n/a
4 TRCN0000079653 CCCATAGTTATCAGCCACCTA pLKO.1 2559 3UTR 100% 2.640 2.112 N Slc16a3 n/a
5 TRCN0000079654 GCTGGATGCAACCAAAGTTTA pLKO.1 2079 CDS 100% 13.200 9.240 N Slc16a3 n/a
6 TRCN0000444225 TCTTTGTGCCTCCGGTCTTTG pLKO_005 1673 CDS 100% 10.800 7.560 N Slc16a3 n/a
7 TRCN0000079655 CTGGGCTTCATCGACATCTTT pLKO.1 1756 CDS 100% 5.625 3.938 N Slc16a3 n/a
8 TRCN0000079656 CCTCATCATGCTCAATCGATA pLKO.1 1335 CDS 100% 4.950 3.465 N Slc16a3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249322.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.