Transcript: Mouse XM_011249596.1

PREDICTED: Mus musculus mitochondrial ribosomal protein L1 (Mrpl1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mrpl1 (94061)
Length:
2182
CDS:
298..1062

Additional Resources:

NCBI RefSeq record:
XM_011249596.1
NBCI Gene record:
Mrpl1 (94061)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249596.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177408 GCTACTAGAAATTCCATTGGT pLKO.1 727 CDS 100% 3.000 4.200 N Mrpl1 n/a
2 TRCN0000197476 CAATCCAAAGCAAGGTGTTTA pLKO.1 411 CDS 100% 13.200 10.560 N Mrpl1 n/a
3 TRCN0000328163 GAAACAACAGAGGCATCTATA pLKO_005 1104 3UTR 100% 13.200 9.240 N Mrpl1 n/a
4 TRCN0000177093 CAAGGTGTTTATCTTGACTTA pLKO.1 421 CDS 100% 4.950 3.465 N Mrpl1 n/a
5 TRCN0000328093 CAAGGTGTTTATCTTGACTTA pLKO_005 421 CDS 100% 4.950 3.465 N Mrpl1 n/a
6 TRCN0000182758 CAGGAGGAACAGATCTGGTTA pLKO.1 599 CDS 100% 4.950 3.465 N Mrpl1 n/a
7 TRCN0000176786 CCAGAAATAATGGGTGAACTT pLKO.1 667 CDS 100% 4.950 3.465 N Mrpl1 n/a
8 TRCN0000197524 CTGAAACGGAAGAAACTCAAA pLKO.1 1025 CDS 100% 4.950 3.465 N Mrpl1 n/a
9 TRCN0000178588 CTTCGTAGTTCAACCAGTGAA pLKO.1 949 CDS 100% 4.950 3.465 N Mrpl1 n/a
10 TRCN0000328162 CTTCGTAGTTCAACCAGTGAA pLKO_005 949 CDS 100% 4.950 3.465 N Mrpl1 n/a
11 TRCN0000178453 GATATGCCAAGTGACCAGATA pLKO.1 847 CDS 100% 4.950 3.465 N Mrpl1 n/a
12 TRCN0000176699 CTGGTTAAGAAGATCATGGAT pLKO.1 613 CDS 100% 3.000 2.100 N Mrpl1 n/a
13 TRCN0000328161 CTGGTTAAGAAGATCATGGAT pLKO_005 613 CDS 100% 3.000 2.100 N Mrpl1 n/a
14 TRCN0000177012 GCAGTTATAAATGAGGTCTGT pLKO.1 883 CDS 100% 2.640 1.848 N Mrpl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249596.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.