Transcript: Mouse XM_011249809.2

PREDICTED: Mus musculus vesicle-associated membrane protein 7 (Vamp7), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Vamp7 (20955)
Length:
2460
CDS:
180..725

Additional Resources:

NCBI RefSeq record:
XM_011249809.2
NBCI Gene record:
Vamp7 (20955)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249809.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336077 TTACGGTTCAAGAGCACAAAC pLKO_005 329 CDS 100% 10.800 15.120 N Vamp7 n/a
2 TRCN0000380733 TAAGAGCCTAGACAAAGTGAT pLKO_005 422 CDS 100% 4.950 6.930 N Vamp7 n/a
3 TRCN0000115067 GCACTTCCTTATGCTATGAAT pLKO.1 351 CDS 100% 5.625 4.500 N Vamp7 n/a
4 TRCN0000353419 GCACTTCCTTATGCTATGAAT pLKO_005 351 CDS 100% 5.625 4.500 N Vamp7 n/a
5 TRCN0000353291 CTTTGCCTGTCATATAGTTTG pLKO_005 863 3UTR 100% 10.800 7.560 N Vamp7 n/a
6 TRCN0000336014 TTTGTATCACTGATGATGATT pLKO_005 250 CDS 100% 5.625 3.938 N Vamp7 n/a
7 TRCN0000115070 GCACAAGTGGATGAACTGAAA pLKO.1 453 CDS 100% 4.950 3.465 N Vamp7 n/a
8 TRCN0000336075 GCACAAGTGGATGAACTGAAA pLKO_005 453 CDS 100% 4.950 3.465 N Vamp7 n/a
9 TRCN0000115069 TCGAGCCATGTGTATGAAGAA pLKO.1 599 CDS 100% 4.950 3.465 N Vamp7 n/a
10 TRCN0000380436 GCACAACTGAAGCATCACTCT pLKO_005 396 CDS 100% 2.640 1.848 N Vamp7 n/a
11 TRCN0000293927 TTGTATCACTGATGATGATTT pLKO_005 251 CDS 100% 13.200 7.920 N VAMP7 n/a
12 TRCN0000115066 CCTGTCATATAGTTTGTGTTA pLKO.1 868 3UTR 100% 4.950 2.970 N Vamp7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249809.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.