Transcript: Mouse XM_011250240.1

PREDICTED: Mus musculus multiple EGF-like-domains 6 (Megf6), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Megf6 (230971)
Length:
6740
CDS:
306..4895

Additional Resources:

NCBI RefSeq record:
XM_011250240.1
NBCI Gene record:
Megf6 (230971)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250240.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339384 GCAAACACTGTCGTAAGAAAT pLKO_005 2122 CDS 100% 13.200 18.480 N Megf6 n/a
2 TRCN0000339321 GCGCAGGACTGTGTACTATAT pLKO_005 554 CDS 100% 13.200 18.480 N Megf6 n/a
3 TRCN0000339322 GGCCAGGCTGTGAACAAATTT pLKO_005 4075 CDS 100% 15.000 12.000 N Megf6 n/a
4 TRCN0000339388 CAGCTATGGATAGTCATATAG pLKO_005 5026 3UTR 100% 13.200 9.240 N Megf6 n/a
5 TRCN0000339323 CATTCCTGTCTCTGCCGAAAT pLKO_005 3441 CDS 100% 10.800 7.560 N Megf6 n/a
6 TRCN0000055522 CCTGTGAAGATGTGGACGAAT pLKO.1 1156 CDS 100% 4.950 2.970 N MEGF6 n/a
7 TRCN0000055520 GCTGCCAGAGAGCCTGTGATA pLKO.1 2875 CDS 100% 1.650 0.990 N MEGF6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250240.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.