Transcript: Mouse XM_011250263.1

PREDICTED: Mus musculus mitochondrial trans-2-enoyl-CoA reductase (Mecr), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mecr (26922)
Length:
3612
CDS:
2420..3430

Additional Resources:

NCBI RefSeq record:
XM_011250263.1
NBCI Gene record:
Mecr (26922)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250263.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127200 GACCCGACATCAAGAAGCTAA pLKO.1 2961 CDS 100% 4.950 6.930 N Mecr n/a
2 TRCN0000245051 ATCAATCCATCTGACATAAAT pLKO_005 2552 CDS 100% 15.000 12.000 N MECR n/a
3 TRCN0000127199 CCTCTGTGAGTCTGCTCATTT pLKO.1 3192 CDS 100% 13.200 9.240 N Mecr n/a
4 TRCN0000127203 CCCGACATCAAGAAGCTAACT pLKO.1 2963 CDS 100% 4.950 3.465 N Mecr n/a
5 TRCN0000063084 CCCTATCAATCCATCTGACAT pLKO.1 2548 CDS 100% 4.950 3.465 N MECR n/a
6 TRCN0000063085 CTCAACTGTGTTGGTGGGAAA pLKO.1 3089 CDS 100% 4.050 2.430 N MECR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250263.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.