Transcript: Mouse XM_011250331.2

PREDICTED: Mus musculus centrosomal protein 85 (Cep85), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cep85 (70012)
Length:
3702
CDS:
149..2281

Additional Resources:

NCBI RefSeq record:
XM_011250331.2
NBCI Gene record:
Cep85 (70012)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250331.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250446 GTTCGGAGCACCTAAGATAAA pLKO_005 3151 3UTR 100% 13.200 18.480 N Cep85 n/a
2 TRCN0000250447 GCCATGCTAGAGACGTTATAC pLKO_005 566 CDS 100% 13.200 10.560 N Cep85 n/a
3 TRCN0000137501 CCATGTGATGCCTTCTACTTT pLKO.1 268 CDS 100% 5.625 4.500 N CEP85 n/a
4 TRCN0000173443 CACAATCCTAACCTCTCACTA pLKO.1 2084 CDS 100% 4.950 3.960 N Cep85 n/a
5 TRCN0000194445 GCAGTTGGAATTGATCCGTTT pLKO.1 856 CDS 100% 4.050 3.240 N Cep85 n/a
6 TRCN0000229267 AGGGTCAAAGGTCGTGATAAA pLKO_005 1331 CDS 100% 13.200 9.240 N CEP85 n/a
7 TRCN0000250448 AGGGTCAAAGGTCGTGATAAA pLKO_005 1331 CDS 100% 13.200 9.240 N Cep85 n/a
8 TRCN0000258065 CAGCTTAAGGACGCTGAATTA pLKO_005 1484 CDS 100% 13.200 9.240 N Cep85 n/a
9 TRCN0000175441 CCTGTATGTATGAGGAGTAAA pLKO.1 3326 3UTR 100% 13.200 9.240 N Cep85 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250331.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12495 pDONR223 100% 23.9% 23.2% None (many diffs) n/a
2 ccsbBroad304_12495 pLX_304 0% 23.9% 23.2% V5 (many diffs) n/a
Download CSV