Transcript: Mouse XM_011250504.2

PREDICTED: Mus musculus shisa family member 7 (Shisa7), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Shisa7 (232813)
Length:
6074
CDS:
336..1991

Additional Resources:

NCBI RefSeq record:
XM_011250504.2
NBCI Gene record:
Shisa7 (232813)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250504.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197555 CCTCTTCATGTGATGTCATTA pLKO.1 2766 3UTR 100% 13.200 9.240 N Shisa7 n/a
2 TRCN0000176732 CAGAACTGAATCGATACTCTT pLKO.1 1315 CDS 100% 4.950 3.465 N Shisa7 n/a
3 TRCN0000197861 GAAATCAGAACTGAATCGATA pLKO.1 1310 CDS 100% 4.950 3.465 N Shisa7 n/a
4 TRCN0000176459 CAAGAACCTTTACAACACCAT pLKO.1 1112 CDS 100% 2.640 1.848 N Shisa7 n/a
5 TRCN0000198376 GCTGAGAAAGATCTGGATGAA pLKO.1 1350 CDS 100% 4.950 2.970 N Shisa7 n/a
6 TRCN0000182535 GCAAGAACGAAGTGACTGTCT pLKO.1 1969 CDS 100% 2.640 1.584 N Shisa7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250504.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.