Transcript: Mouse XM_011250696.1

PREDICTED: Mus musculus capicua transcriptional repressor (Cic), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cic (71722)
Length:
8313
CDS:
165..7703

Additional Resources:

NCBI RefSeq record:
XM_011250696.1
NBCI Gene record:
Cic (71722)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250696.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000082010 CCAAGGAACGAGACTCATCTT pLKO.1 3418 CDS 100% 4.950 6.930 N Cic n/a
2 TRCN0000331802 CCAAGGAACGAGACTCATCTT pLKO_005 3418 CDS 100% 4.950 6.930 N Cic n/a
3 TRCN0000082012 CCGACATTGATCTCAAGTGCA pLKO.1 4267 CDS 100% 2.640 3.696 N Cic n/a
4 TRCN0000302060 CCGACATTGATCTCAAGTGCA pLKO_005 4267 CDS 100% 2.640 3.696 N Cic n/a
5 TRCN0000304642 AGCGGGAGAAGGACCATATTC pLKO_005 3466 CDS 100% 13.200 9.240 N Cic n/a
6 TRCN0000082009 CCCAACAACCTAGCAAGATTA pLKO.1 5749 CDS 100% 13.200 9.240 N Cic n/a
7 TRCN0000082008 CCTCAGGATATGGACAGTATA pLKO.1 7744 3UTR 100% 13.200 9.240 N Cic n/a
8 TRCN0000304641 TGCAAGCTGGAGGGTAGTATG pLKO_005 7998 3UTR 100% 10.800 7.560 N Cic n/a
9 TRCN0000082011 GTGGACTTTGAAGAGCGGTTT pLKO.1 6933 CDS 100% 4.050 2.835 N Cic n/a
10 TRCN0000302126 GTGGACTTTGAAGAGCGGTTT pLKO_005 6933 CDS 100% 4.050 2.835 N Cic n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250696.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.