Transcript: Mouse XM_011250830.2

PREDICTED: Mus musculus sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B (Sema4b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sema4b (20352)
Length:
4097
CDS:
315..2786

Additional Resources:

NCBI RefSeq record:
XM_011250830.2
NBCI Gene record:
Sema4b (20352)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250830.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000311563 GCACTTATGATGTCCTATTTC pLKO_005 1651 CDS 100% 13.200 18.480 N Sema4b n/a
2 TRCN0000112290 CCACCCATCTTCTAATTCCTA pLKO.1 3663 3UTR 100% 3.000 2.400 N Sema4b n/a
3 TRCN0000339430 AGCACTTATGATGTCCTATTT pLKO_005 1650 CDS 100% 13.200 9.240 N Sema4b n/a
4 TRCN0000311561 GTGGTATGAGAGCTGACTTTA pLKO_005 2778 CDS 100% 13.200 9.240 N Sema4b n/a
5 TRCN0000339360 ACAAGGAAGACTACAACATAG pLKO_005 3066 3UTR 100% 10.800 7.560 N Sema4b n/a
6 TRCN0000339358 CCCATAGGTGATGATGATAAG pLKO_005 1032 CDS 100% 10.800 7.560 N Sema4b n/a
7 TRCN0000306501 GGCAGAACTCTGCTACTTAAC pLKO_005 2992 3UTR 100% 10.800 7.560 N Sema4b n/a
8 TRCN0000112292 CCCTTTAACGTGCTACAAGAT pLKO.1 1227 CDS 100% 4.950 3.465 N Sema4b n/a
9 TRCN0000112293 GCCATGTAAACAAGTCCAGAT pLKO.1 2051 CDS 100% 4.050 2.835 N Sema4b n/a
10 TRCN0000326923 GCCATGTAAACAAGTCCAGAT pLKO_005 2051 CDS 100% 4.050 2.835 N Sema4b n/a
11 TRCN0000112294 GCGAGCTTTACTTTAGCCCAA pLKO.1 765 CDS 100% 2.160 1.512 N Sema4b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250830.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.