Transcript: Mouse XM_011250863.2

PREDICTED: Mus musculus multiple C2 domains, transmembrane 2 (Mctp2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mctp2 (244049)
Length:
4126
CDS:
154..2250

Additional Resources:

NCBI RefSeq record:
XM_011250863.2
NBCI Gene record:
Mctp2 (244049)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250863.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426162 GTCAAATCGGAAGCGGTTAAG pLKO_005 1128 CDS 100% 10.800 15.120 N Mctp2 n/a
2 TRCN0000026940 GAACCCAATTTGGGATGAGAT pLKO.1 867 CDS 100% 4.950 6.930 N Gm1455 n/a
3 TRCN0000026890 GCATTTGTCGTTCTCAGAGAT pLKO.1 976 CDS 100% 4.950 6.930 N Gm1455 n/a
4 TRCN0000028228 CCTCATATATAATCCGGTCAA pLKO.1 2028 CDS 100% 4.050 5.670 N Mctp2 n/a
5 TRCN0000419035 CAAGCAAACCTTTGGATTTAA pLKO_005 248 CDS 100% 15.000 10.500 N Mctp2 n/a
6 TRCN0000026873 TGGGAGTGATTGTGTTAAATT pLKO.1 1064 CDS 100% 15.000 10.500 N Gm1455 n/a
7 TRCN0000425813 AGCGAACCAGACCTTTGTTAA pLKO_005 194 CDS 100% 13.200 9.240 N Mctp2 n/a
8 TRCN0000427585 AGGTGTATGATCGAGACTTAA pLKO_005 932 CDS 100% 13.200 9.240 N Mctp2 n/a
9 TRCN0000419428 ATAAGAACTTGAACCCAATTT pLKO_005 857 CDS 100% 13.200 9.240 N Mctp2 n/a
10 TRCN0000028277 CCAGTGAAAGACAGCAGATTT pLKO.1 1610 CDS 100% 13.200 9.240 N Mctp2 n/a
11 TRCN0000434392 TGGAATGGGATTATAAGTATA pLKO_005 1213 CDS 100% 13.200 9.240 N Mctp2 n/a
12 TRCN0000432788 CCGACTCTGAAGAGATCTATG pLKO_005 506 CDS 100% 10.800 7.560 N Mctp2 n/a
13 TRCN0000425176 GACTTCAGACACATACCATTT pLKO_005 1778 CDS 100% 10.800 7.560 N Mctp2 n/a
14 TRCN0000026889 CGGAAGAACCAACTCTGGAAT pLKO.1 1198 CDS 100% 4.950 3.465 N Gm1455 n/a
15 TRCN0000026866 CCAAGTCTGATTTCATGGGTT pLKO.1 953 CDS 100% 2.640 1.848 N Gm1455 n/a
16 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 4067 3UTR 100% 4.950 2.475 Y Gad2 n/a
17 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 4005 3UTR 100% 4.050 2.025 Y Mtif2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250863.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.