Transcript: Mouse XM_011250926.2

PREDICTED: Mus musculus predicted gene, 33989 (Gm33989), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm33989 (102637087)
Length:
16566
CDS:
854..3409

Additional Resources:

NCBI RefSeq record:
XM_011250926.2
NBCI Gene record:
Gm33989 (102637087)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250926.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229445 AGGATAGAATTAGGGTAATTT pLKO_005 6098 3UTR 100% 15.000 21.000 N Gm4790 n/a
2 TRCN0000229443 GCATGCAAGCGGTGTGATAAA pLKO_005 1625 CDS 100% 13.200 18.480 N Gm4790 n/a
3 TRCN0000229442 ACATTGACGAGCAGTACAAAC pLKO_005 909 CDS 100% 10.800 15.120 N Gm4790 n/a
4 TRCN0000229444 GTCTCGATATTTACTTCAAAT pLKO_005 2920 CDS 100% 13.200 9.240 N Gm4790 n/a
5 TRCN0000243739 GAATGTAAACAATGTGGTAAA pLKO_005 2729 CDS 100% 10.800 5.400 Y Gm14411 n/a
6 TRCN0000420991 AGTGTGAAGAGTGTGGAAATT pLKO_005 1374 CDS 100% 13.200 6.600 Y Zfp874a n/a
7 TRCN0000016730 CTGGAGAGAAACCTTATGAAT pLKO.1 3042 CDS 100% 5.625 2.813 Y ZNF345 n/a
8 TRCN0000235346 ATGTAAGCAATGTAGTAAATC pLKO_005 2131 CDS 100% 13.200 6.600 Y 5430403G16Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250926.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.