Transcript: Mouse XM_011250993.2

PREDICTED: Mus musculus ecto-NOX disulfide-thiol exchanger 2 (Enox2), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Enox2 (209224)
Length:
3437
CDS:
718..2703

Additional Resources:

NCBI RefSeq record:
XM_011250993.2
NBCI Gene record:
Enox2 (209224)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250993.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062020 GCCACAGCAATGAATAATCTT pLKO.1 964 CDS 100% 5.625 7.875 N ENOX2 n/a
2 TRCN0000127371 GCTGAGGAAATTCGCAACATT pLKO.1 1939 CDS 100% 5.625 7.875 N Enox2 n/a
3 TRCN0000127370 GCTACCAAATACCCAGCAAAT pLKO.1 2519 CDS 100% 10.800 8.640 N Enox2 n/a
4 TRCN0000127373 CCTTGGGATGATGACTGGAAT pLKO.1 1041 CDS 100% 4.950 3.465 N Enox2 n/a
5 TRCN0000127372 GCCTGGTAAATGAGAAAGCTA pLKO.1 1748 CDS 100% 3.000 2.100 N Enox2 n/a
6 TRCN0000062018 CGCAACATTCATAATGATGAA pLKO.1 1951 CDS 100% 0.495 0.347 N ENOX2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250993.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11507 pDONR223 100% 39.2% 35.3% None (many diffs) n/a
2 ccsbBroad304_11507 pLX_304 0% 39.2% 35.3% V5 (many diffs) n/a
3 TRCN0000465311 GCCAACATGTGCCCTCTAACCCGT pLX_317 22.5% 39.2% 35.3% V5 (many diffs) n/a
Download CSV