Transcript: Human XM_011509205.1

PREDICTED: Homo sapiens complement C3b/C4b receptor 1 (Knops blood group) (CR1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CR1 (1378)
Length:
10103
CDS:
102..7766

Additional Resources:

NCBI RefSeq record:
XM_011509205.1
NBCI Gene record:
CR1 (1378)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011509205.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029628 CCTCTCTTGGATAATTCTAAA pLKO.1 7436 CDS 100% 13.200 10.560 N CR1 n/a
2 TRCN0000029626 CCTCGGTGTATTTCTACTAAT pLKO.1 6213 CDS 100% 13.200 9.240 N CR1 n/a
3 TRCN0000029627 CGTGTGCTATTTCCAGTAAAT pLKO.1 1221 CDS 100% 13.200 9.240 N CR1 n/a
4 TRCN0000029624 GCCTGGAATTTCTGGTTTGTA pLKO.1 8054 3UTR 100% 5.625 3.938 N CR1 n/a
5 TRCN0000029625 GCCGCCAATTTGTCAACGAAT pLKO.1 1937 CDS 100% 4.950 3.465 N CR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011509205.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.