Transcript: Human XM_011509466.2

PREDICTED: Homo sapiens ankyrin repeat domain 45 (ANKRD45), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANKRD45 (339416)
Length:
1893
CDS:
509..1309

Additional Resources:

NCBI RefSeq record:
XM_011509466.2
NBCI Gene record:
ANKRD45 (339416)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011509466.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435318 ACTACTCAGAGAATCTAATAA pLKO_005 1585 3UTR 100% 15.000 10.500 N ANKRD45 n/a
2 TRCN0000429993 AGGAAAGCACTTGGGTATAAA pLKO_005 1532 3UTR 100% 15.000 10.500 N ANKRD45 n/a
3 TRCN0000414032 CGAGATGTTGCTGCTAGATAT pLKO_005 947 CDS 100% 13.200 9.240 N ANKRD45 n/a
4 TRCN0000150227 GAGATGTTGCTGCTAGATATT pLKO.1 948 CDS 100% 13.200 9.240 N ANKRD45 n/a
5 TRCN0000148518 CCCATACAGAAGCTTCCATTA pLKO.1 1146 CDS 100% 10.800 7.560 N ANKRD45 n/a
6 TRCN0000149171 GAGGGTACACACTCTTACATT pLKO.1 834 CDS 100% 5.625 3.938 N ANKRD45 n/a
7 TRCN0000149101 GACTACACCATGTCAAGTGAA pLKO.1 1228 CDS 100% 4.950 3.465 N ANKRD45 n/a
8 TRCN0000149548 GATCCTGAGAATCCTCATCAT pLKO.1 677 CDS 100% 4.950 3.465 N ANKRD45 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011509466.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05460 pDONR223 100% 100% 100% None n/a
Download CSV