Transcript: Human XM_011510146.2

PREDICTED: Homo sapiens dual specificity phosphatase 27, atypical (DUSP27), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DUSP27 (92235)
Length:
4036
CDS:
155..3514

Additional Resources:

NCBI RefSeq record:
XM_011510146.2
NBCI Gene record:
DUSP27 (92235)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510146.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359951 GCGGACCAACTGATACCATTT pLKO_005 3730 3UTR 100% 10.800 15.120 N DUSP27 n/a
2 TRCN0000359950 GATGACACCAGCCTCTATAAT pLKO_005 350 CDS 100% 15.000 10.500 N DUSP27 n/a
3 TRCN0000359952 CAGAACCACAGCGCCCAAATT pLKO_005 3201 CDS 100% 13.200 9.240 N DUSP27 n/a
4 TRCN0000360012 CATAGGGAGCTTCCGATATTC pLKO_005 2713 CDS 100% 13.200 9.240 N DUSP27 n/a
5 TRCN0000082729 GCAGCCAAACAGATCATCAAT pLKO.1 218 CDS 100% 5.625 3.938 N DUSP27 n/a
6 TRCN0000082728 CCGATATTCTTCCCGCAGTAA pLKO.1 2725 CDS 100% 4.950 3.465 N DUSP27 n/a
7 TRCN0000082732 GACTTTCCTGAGGTGGACATT pLKO.1 614 CDS 100% 4.950 3.465 N DUSP27 n/a
8 TRCN0000082731 CTTCTCTGAATTTGGAGCCAA pLKO.1 3271 CDS 100% 2.640 1.848 N DUSP27 n/a
9 TRCN0000082730 CAAGAGAATCCAATTTGGATT pLKO.1 1684 CDS 100% 0.495 0.347 N DUSP27 n/a
10 TRCN0000080909 GCCAGTATCCAGAACTGGATT pLKO.1 2198 CDS 100% 0.495 0.347 N Dusp27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510146.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.