Transcript: Human XM_011510315.2

PREDICTED: Homo sapiens solute carrier family 66 member 3 (SLC66A3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC66A3 (130814)
Length:
4726
CDS:
81..452

Additional Resources:

NCBI RefSeq record:
XM_011510315.2
NBCI Gene record:
SLC66A3 (130814)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510315.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245603 CTACCGGAAGACCGCTATAAA pLKO_005 496 3UTR 100% 15.000 21.000 N SLC66A3 n/a
2 TRCN0000245606 CACTCCTTACATCGCTGTATT pLKO_005 359 CDS 100% 13.200 18.480 N SLC66A3 n/a
3 TRCN0000245605 TCCTCACTTCGTTAGGTTATG pLKO_005 717 3UTR 100% 10.800 15.120 N SLC66A3 n/a
4 TRCN0000245604 CTGAATGATGGATACATTATT pLKO_005 519 3UTR 100% 15.000 10.500 N SLC66A3 n/a
5 TRCN0000245602 CCCTGCAGAAGTGGATCATAG pLKO_005 403 CDS 100% 10.800 7.560 N SLC66A3 n/a
6 TRCN0000183349 GCTTTCTGATTCAAGTACAAT pLKO.1 1209 3UTR 100% 5.625 3.938 N SLC66A3 n/a
7 TRCN0000180057 CCACTCCTTACATCGCTGTAT pLKO.1 358 CDS 100% 4.950 3.465 N SLC66A3 n/a
8 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 4585 3UTR 100% 10.800 5.400 Y MRPS16 n/a
9 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 4585 3UTR 100% 10.800 5.400 Y CD3EAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510315.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09529 pDONR223 100% 60.1% 58.4% None (many diffs) n/a
Download CSV