Transcript: Human XM_011510325.1

PREDICTED: Homo sapiens myelin transcription factor 1 like (MYT1L), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MYT1L (23040)
Length:
7307
CDS:
930..4553

Additional Resources:

NCBI RefSeq record:
XM_011510325.1
NBCI Gene record:
MYT1L (23040)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510325.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012109 CGTGACTACTTTGACGGAAAT pLKO.1 4445 CDS 100% 10.800 15.120 N Myt1l n/a
2 TRCN0000020864 CCGATATGATTAAACTCAGAA pLKO.1 4237 CDS 100% 4.950 6.930 N MYT1L n/a
3 TRCN0000020868 CCATCGCTTTGGAAACGGAAA pLKO.1 2239 CDS 100% 4.050 5.670 N MYT1L n/a
4 TRCN0000012110 CGACAACCATACTTATGGCAA pLKO.1 2876 CDS 100% 2.640 3.696 N Myt1l n/a
5 TRCN0000020866 CGAAAGCCATTTGCCGTGAAA pLKO.1 1152 CDS 100% 4.950 3.960 N MYT1L n/a
6 TRCN0000020867 GCAGCAAGACAGTAGAAATAT pLKO.1 1799 CDS 100% 15.000 10.500 N MYT1L n/a
7 TRCN0000020865 CCTCGTTTGAATACAACAGTT pLKO.1 2854 CDS 100% 4.950 3.465 N MYT1L n/a
8 TRCN0000163739 GAAGAAGAGGAAGAGGAGGAA pLKO.1 1383 CDS 100% 2.640 1.320 Y CCDC88B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510325.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.