Transcript: Human XM_011510503.2

PREDICTED: Homo sapiens ectodysplasin A receptor (EDAR), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EDAR (10913)
Length:
3970
CDS:
44..1534

Additional Resources:

NCBI RefSeq record:
XM_011510503.2
NBCI Gene record:
EDAR (10913)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510503.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358920 CAAGTCAGCCGGGATTCAAAG pLKO_005 1138 CDS 100% 10.800 15.120 N EDAR n/a
2 TRCN0000358854 GACTAGAGCCGGGATACTTTC pLKO_005 1717 3UTR 100% 10.800 15.120 N EDAR n/a
3 TRCN0000358921 TCAAGGAGCCAGACGAAATAA pLKO_005 1665 3UTR 100% 15.000 10.500 N EDAR n/a
4 TRCN0000358853 ACGATGCCTCATCCGAGAATG pLKO_005 996 CDS 100% 10.800 7.560 N EDAR n/a
5 TRCN0000059233 CCTCATCATCATGTTCTACAT pLKO.1 796 CDS 100% 4.950 3.465 N EDAR n/a
6 TRCN0000059236 CGGTGAGAACGAGTACTACAA pLKO.1 280 CDS 100% 4.950 3.465 N EDAR n/a
7 TRCN0000059237 CGGGATTCAAAGCCGGAGGAA pLKO.1 1147 CDS 100% 0.880 0.616 N EDAR n/a
8 TRCN0000059234 GCCATTTGATTGCCTCGAGAA pLKO.1 1231 CDS 100% 0.000 0.000 N EDAR n/a
9 TRCN0000059235 CGAGAAGGATGAATTTGAGAA pLKO.1 937 CDS 100% 4.950 2.970 N EDAR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510503.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.