Transcript: Human XM_011510590.1

PREDICTED: Homo sapiens coiled-coil domain containing 173 (CCDC173), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC173 (129881)
Length:
2090
CDS:
259..1674

Additional Resources:

NCBI RefSeq record:
XM_011510590.1
NBCI Gene record:
CCDC173 (129881)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510590.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264078 ACAAGCAGAATTAGATTATTG pLKO_005 1365 CDS 100% 13.200 9.240 N CCDC173 n/a
2 TRCN0000264076 AGGTTCAAGATGCCCATATTC pLKO_005 1304 CDS 100% 13.200 9.240 N CCDC173 n/a
3 TRCN0000264075 GACTATGCCAGAGAGGTAATT pLKO_005 1432 CDS 100% 13.200 9.240 N CCDC173 n/a
4 TRCN0000282909 TGTGGACAGAGGTGGATTAAG pLKO_005 1542 CDS 100% 13.200 9.240 N CCDC173 n/a
5 TRCN0000264077 GACTAAGTTGTAGCATATATG pLKO_005 1701 3UTR 100% 13.200 6.600 Y CCDC173 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510590.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13150 pDONR223 100% 86.2% 86.2% None 0_1ins225 n/a
2 ccsbBroad304_13150 pLX_304 0% 86.2% 86.2% V5 0_1ins225 n/a
Download CSV