Transcript: Human XM_011510672.2

PREDICTED: Homo sapiens prominin 2 (PROM2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PROM2 (150696)
Length:
1767
CDS:
123..1592

Additional Resources:

NCBI RefSeq record:
XM_011510672.2
NBCI Gene record:
PROM2 (150696)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510672.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000164968 GATGGTGTTGGTGTGAGCATT pLKO.1 801 CDS 100% 4.950 3.465 N PROM2 n/a
2 TRCN0000165765 CCTTTCCCTTCAGAGTTGGTA pLKO.1 354 CDS 100% 3.000 2.100 N PROM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510672.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15266 pDONR223 90% 57.7% 64.6% None (many diffs) n/a
2 ccsbBroad304_15266 pLX_304 0% 57.7% 64.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV