Transcript: Human XM_011511058.3

PREDICTED: Homo sapiens high density lipoprotein binding protein (HDLBP), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HDLBP (3069)
Length:
4791
CDS:
596..4402

Additional Resources:

NCBI RefSeq record:
XM_011511058.3
NBCI Gene record:
HDLBP (3069)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011511058.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153864 CGGTGCCAACATAAACAGAAT pLKO.1 1957 CDS 100% 4.950 6.930 N HDLBP n/a
2 TRCN0000155065 GCGGTGCCAACATAAACAGAA pLKO.1 1956 CDS 100% 4.950 6.930 N HDLBP n/a
3 TRCN0000292471 GCGGTGCCAACATAAACAGAA pLKO_005 1956 CDS 100% 4.950 6.930 N HDLBP n/a
4 TRCN0000153797 CCGTAAATTGTTGACGCTCTT pLKO.1 4493 3UTR 100% 4.050 5.670 N HDLBP n/a
5 TRCN0000154305 CCGTTACGTTATTGGGCAGAA pLKO.1 3547 CDS 100% 4.050 5.670 N HDLBP n/a
6 TRCN0000297988 CCGTTACGTTATTGGGCAGAA pLKO_005 3547 CDS 100% 4.050 5.670 N HDLBP n/a
7 TRCN0000154197 CCATCGCTTTGTTATTGGCAA pLKO.1 1078 CDS 100% 2.640 3.696 N HDLBP n/a
8 TRCN0000151220 GCTCGCATCAAGAAGATTTAT pLKO.1 1439 CDS 100% 15.000 12.000 N HDLBP n/a
9 TRCN0000150941 GCTCCACTGTTTAACACTAAA pLKO.1 4601 3UTR 100% 13.200 9.240 N HDLBP n/a
10 TRCN0000154388 CCAGCAGATTACTCGGGATTT pLKO.1 3283 CDS 100% 10.800 7.560 N HDLBP n/a
11 TRCN0000292468 CCAGCAGATTACTCGGGATTT pLKO_005 3283 CDS 100% 10.800 7.560 N HDLBP n/a
12 TRCN0000153823 CGTTACGTTATTGGGCAGAAA pLKO.1 3548 CDS 100% 4.950 3.465 N HDLBP n/a
13 TRCN0000154928 GCCAAGCCAGAATACCACAAA pLKO.1 2795 CDS 100% 4.950 3.465 N HDLBP n/a
14 TRCN0000292469 GCCAAGCCAGAATACCACAAA pLKO_005 2795 CDS 100% 4.950 3.465 N HDLBP n/a
15 TRCN0000154496 GCATGACGTGAACATCCAGTT pLKO.1 3838 CDS 100% 4.050 2.835 N HDLBP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011511058.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.