Transcript: Human XM_011511199.2

PREDICTED: Homo sapiens alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase (MGAT5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MGAT5 (4249)
Length:
8794
CDS:
795..3020

Additional Resources:

NCBI RefSeq record:
XM_011511199.2
NBCI Gene record:
MGAT5 (4249)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011511199.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436389 GGCGGAAATTCGTACAGATTT pLKO_005 1439 CDS 100% 13.200 18.480 N MGAT5 n/a
2 TRCN0000415512 AGTGATATCCACCACATTAAT pLKO_005 2097 CDS 100% 15.000 12.000 N MGAT5 n/a
3 TRCN0000036059 CCCGAATTTAATCATGCAAAT pLKO.1 1944 CDS 100% 10.800 7.560 N MGAT5 n/a
4 TRCN0000036063 GCTGGAGTCATGACAGCTTAT pLKO.1 1014 CDS 100% 10.800 7.560 N MGAT5 n/a
5 TRCN0000036060 CCCTCCTTTGACCCTAAGAAT pLKO.1 2871 CDS 100% 5.625 3.938 N MGAT5 n/a
6 TRCN0000036061 CCTACGAAGAAGCTGATCATA pLKO.1 1411 CDS 100% 5.625 3.938 N MGAT5 n/a
7 TRCN0000036062 CGAGAAACCAAGTTGTTTGTT pLKO.1 2313 CDS 100% 5.625 3.938 N MGAT5 n/a
8 TRCN0000427110 CTCCGAGTCCTTGATTCATTT pLKO_005 1914 CDS 100% 13.200 7.920 N MGAT5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011511199.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.