Transcript: Human XM_011511871.3

PREDICTED: Homo sapiens tetratricopeptide repeat domain 21B (TTC21B), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TTC21B (79809)
Length:
8723
CDS:
4130..7330

Additional Resources:

NCBI RefSeq record:
XM_011511871.3
NBCI Gene record:
TTC21B (79809)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011511871.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253632 GGGAATGGCAACGGCTTATAT pLKO_005 6862 CDS 100% 15.000 21.000 N Ttc21b n/a
2 TRCN0000441401 GATAAGGCCCGTGCGTCTTTA pLKO_005 7301 CDS 100% 13.200 18.480 N TTC21B n/a
3 TRCN0000419146 TCACGTACAGCTTCGCATAAT pLKO_005 6733 CDS 100% 13.200 18.480 N TTC21B n/a
4 TRCN0000168470 GCATTAAATCAGAACCCGAAA pLKO.1 5621 CDS 100% 4.050 5.670 N TTC21B n/a
5 TRCN0000416245 GTTGGAACTGGCACGATTATA pLKO_005 6142 CDS 100% 15.000 10.500 N TTC21B n/a
6 TRCN0000166961 GCATTAAATACCTTCACTGAA pLKO.1 6803 CDS 100% 4.950 3.465 N TTC21B n/a
7 TRCN0000168625 GCTTTAAGCATCCTTCAGAAT pLKO.1 5396 CDS 100% 4.950 3.465 N TTC21B n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 7978 3UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 7978 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011511871.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.