Transcript: Human XM_011511872.2

PREDICTED: Homo sapiens tetratricopeptide repeat domain 21B (TTC21B), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TTC21B (79809)
Length:
5451
CDS:
77..2905

Additional Resources:

NCBI RefSeq record:
XM_011511872.2
NBCI Gene record:
TTC21B (79809)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011511872.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253632 GGGAATGGCAACGGCTTATAT pLKO_005 3590 3UTR 100% 15.000 21.000 N Ttc21b n/a
2 TRCN0000441401 GATAAGGCCCGTGCGTCTTTA pLKO_005 4029 3UTR 100% 13.200 18.480 N TTC21B n/a
3 TRCN0000419146 TCACGTACAGCTTCGCATAAT pLKO_005 3461 3UTR 100% 13.200 18.480 N TTC21B n/a
4 TRCN0000168470 GCATTAAATCAGAACCCGAAA pLKO.1 2318 CDS 100% 4.050 5.670 N TTC21B n/a
5 TRCN0000172485 CGCCATGATAAAGCAAGGGAA pLKO.1 443 CDS 100% 2.640 3.696 N TTC21B n/a
6 TRCN0000416245 GTTGGAACTGGCACGATTATA pLKO_005 2870 CDS 100% 15.000 10.500 N TTC21B n/a
7 TRCN0000166961 GCATTAAATACCTTCACTGAA pLKO.1 3531 3UTR 100% 4.950 3.465 N TTC21B n/a
8 TRCN0000168625 GCTTTAAGCATCCTTCAGAAT pLKO.1 2093 CDS 100% 4.950 3.465 N TTC21B n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4706 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4706 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011511872.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.