Transcript: Human XM_011511876.2

PREDICTED: Homo sapiens transmembrane 4 L six family member 20 (TM4SF20), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TM4SF20 (79853)
Length:
2317
CDS:
146..634

Additional Resources:

NCBI RefSeq record:
XM_011511876.2
NBCI Gene record:
TM4SF20 (79853)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011511876.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159576 CGTAGAAAGCACGTTGTAAAT pLKO.1 737 3UTR 100% 13.200 18.480 N TM4SF20 n/a
2 TRCN0000434719 CTAAGCGAAGAAGTCAAATTG pLKO_005 609 CDS 100% 13.200 10.560 N TM4SF20 n/a
3 TRCN0000431797 CCTCCTACTGGTTTCAATAAA pLKO_005 401 CDS 100% 15.000 10.500 N TM4SF20 n/a
4 TRCN0000422126 CTCTGTATTGCATGCTGATAT pLKO_005 237 CDS 100% 13.200 9.240 N TM4SF20 n/a
5 TRCN0000418241 ATTCTCCAAGCAACAGTAATG pLKO_005 294 CDS 100% 10.800 7.560 N TM4SF20 n/a
6 TRCN0000419544 CTCATATCAGTGGTTGATTTG pLKO_005 768 3UTR 100% 10.800 7.560 N TM4SF20 n/a
7 TRCN0000158531 CCTGAAGGTAATTTCACACAA pLKO.1 1710 3UTR 100% 4.950 3.465 N TM4SF20 n/a
8 TRCN0000161181 GAGAGCATCTAGTTTCCACTT pLKO.1 454 CDS 100% 4.050 2.835 N TM4SF20 n/a
9 TRCN0000164091 CCTCCTAAAGTGCTGCGATTA pLKO.1 1180 3UTR 100% 10.800 5.400 Y TM4SF20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011511876.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08969 pDONR223 100% 70.5% 70.3% None 0_1ins201;64C>T n/a
2 ccsbBroad304_08969 pLX_304 0% 70.5% 70.3% V5 0_1ins201;64C>T n/a
Download CSV