Transcript: Human XM_011511929.2

PREDICTED: Homo sapiens Wnt family member 10A (WNT10A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WNT10A (80326)
Length:
1985
CDS:
168..1325

Additional Resources:

NCBI RefSeq record:
XM_011511929.2
NBCI Gene record:
WNT10A (80326)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011511929.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434414 TAGGAAGCTGCACCGCTTACA pLKO_005 584 CDS 100% 4.950 6.930 N WNT10A n/a
2 TRCN0000157775 CCACGAATGCCAACACCAATT pLKO.1 350 CDS 100% 10.800 8.640 N WNT10A n/a
3 TRCN0000433652 CATTCCCTTCATCATTCATTT pLKO_005 1785 3UTR 100% 13.200 9.240 N WNT10A n/a
4 TRCN0000421017 AGAGACATCCACGCGAGAATG pLKO_005 777 CDS 100% 10.800 7.560 N WNT10A n/a
5 TRCN0000157776 CCTATGAGAGTCCCATCTTCA pLKO.1 421 CDS 100% 4.950 3.465 N WNT10A n/a
6 TRCN0000157391 GAGGAGATTGGACCACATGAT pLKO.1 1428 3UTR 100% 4.950 3.465 N WNT10A n/a
7 TRCN0000157588 GTCAGCACCCAATGACATTCT pLKO.1 185 CDS 100% 4.950 3.465 N WNT10A n/a
8 TRCN0000157457 GAAGAGGAGATTGGACCACAT pLKO.1 1425 3UTR 100% 4.050 2.835 N WNT10A n/a
9 TRCN0000156539 GTCAGTCTGTCTCCATCCTTT pLKO.1 1633 3UTR 100% 4.950 2.970 N WNT10A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011511929.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.