Transcript: Human XM_011512025.1

PREDICTED: Homo sapiens plakophilin 4 (PKP4), transcript variant X20, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PKP4 (8502)
Length:
3547
CDS:
243..2795

Additional Resources:

NCBI RefSeq record:
XM_011512025.1
NBCI Gene record:
PKP4 (8502)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011512025.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123181 GCCAACGAAGTACCCTTACAT pLKO.1 589 CDS 100% 5.625 7.875 N PKP4 n/a
2 TRCN0000290198 GCCAACGAAGTACCCTTACAT pLKO_005 589 CDS 100% 5.625 7.875 N PKP4 n/a
3 TRCN0000123362 CCAGCCACCTATGCAGTATTA pLKO.1 2411 CDS 100% 13.200 10.560 N Pkp4 n/a
4 TRCN0000123179 CCCAAGGAACTGTGAGCAATT pLKO.1 3353 3UTR 100% 10.800 7.560 N PKP4 n/a
5 TRCN0000290200 CCCAAGGAACTGTGAGCAATT pLKO_005 3353 3UTR 100% 10.800 7.560 N PKP4 n/a
6 TRCN0000123183 GACTTGCACATTACTCCTATA pLKO.1 438 CDS 100% 10.800 7.560 N PKP4 n/a
7 TRCN0000290199 GACTTGCACATTACTCCTATA pLKO_005 438 CDS 100% 10.800 7.560 N PKP4 n/a
8 TRCN0000123363 GCAGAAGTAAGGGAGCTTGTT pLKO.1 1101 CDS 100% 4.950 3.465 N Pkp4 n/a
9 TRCN0000318017 GCAGAAGTAAGGGAGCTTGTT pLKO_005 1101 CDS 100% 4.950 3.465 N Pkp4 n/a
10 TRCN0000123180 CGACCTTCTTATAGAGCAGAA pLKO.1 2742 CDS 100% 4.050 2.835 N PKP4 n/a
11 TRCN0000290201 CGACCTTCTTATAGAGCAGAA pLKO_005 2742 CDS 100% 4.050 2.835 N PKP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011512025.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.